OnlineCBT
Biology · PYQ NEET UG 2023
Practice questions & answers
Find a question, read its answer and explanation, then practise related questions.
Biology PYQ NEET UG 2023 · Clear filters
57 questions
Biology · PYQ NEET UG 2023
Vital capacity of lung is ________.
Read answer →Biology · PYQ NEET UG 2023
Which of the following is not a cloning vector?
Read answer →Biology · PYQ NEET UG 2023
Radial symmetry is NOT found in adults of phylum
Read answer →Biology · PYQ NEET UG 2023
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as -
Read answer →Biology · PYQ NEET UG 2023
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?
Read answer →Biology · PYQ NEET UG 2023
Match List I with List II.\nList I\nA. Gene 'a'\nB. Gene 'y'\nC. Gene 'i'\nD. Gene 'z'\nList II\nI. \( \beta \)-galactosidase\nII. Transacetylase\nIII. Permease\nIV. Repressor protein\nChoose the correct answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
Match List-I with List-II: List-I List-II A Mast cell I Ciliated epithelium B Inner surface of bronchiole II Areolar connective tissue C Blood III Cuboidal epithelium D Tubular parts of nephron IV pecialised connective tissue Choose the correct answer from the options give below:
Read answer →Biology · PYQ NEET UG 2023
Match List I with List II.\nList I\nA. CCK\nB. GIP\nC. ANF\nD. ADH\nList II\nI. Kidney\nII. Heart\nIII. Gastric gland\nIV. Pancreas\nChoose the correct answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
Which of the following statements are correct?\nA. Basophils are most abundant cells of the total WBCs\nB. Basophils secrete histamine, serotonin and heparin\nC. Basophils are involved in inflammatory response\nD. Basophils have kidney shaped nucleus\nE. Basophils are agranulocytes\nChoose the correct answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
Given below are two statements:\n Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal)\n Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of \( \alpha \) type and two subunits of \( \beta \) type.)\nIn the light of the above statements, choose the correct answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :
Read answer →Biology · PYQ NEET UG 2023
Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
Read answer →Biology · PYQ NEET UG 2023
Given below are two statements:\n Statement I: During \( \text{G}_0 \) phase of cell cycle, the cell is metabolically inactive.\n Statement II: The centrosome undergoes duplication during S phase of interphase.\nIn the light of the above statements, choose the most appropriate answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
Select the correct statements with reference to chordates.\nA. Presence of a mid-dorsal, solid and double nerve cord.\nB. Presence of closed circulatory system.\nC. Presence of paired pharyngeal gillslits.\nD. Presence of dorsal heart\nE. Triploblastic pseudocoelomate animals. \nChoose the correct answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.\nA. Insertion of recombinant DNA into the host cell.\nB. Cutting of DNA at specific location by restriction enzyme.\nC. Isolation of desired DNA fragment.\nD. Amplification of gene of interest using PCR.\nChoose the correct answer from the options given below :
Read answer →Biology · PYQ NEET UG 2023
Which of the following functions is carried out by cytoskeleton in a cell?
Read answer →Biology · PYQ NEET UG 2023
In cockroach, excretion is brought about by- A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
Match List-I with List-II: List-I List-II A P-wave I Beginning of systole B Q-wave II Repolarisation of ventricle C QRS complex III Depolarisation of atria D T-wave IV Depolarisation of ventricle Choose the correct answer from the options given below:
Read answer →Biology · PYQ NEET UG 2023
Broad palm with single palm crease is visible in a person suffering from-
Read answer →Biology · PYQ NEET UG 2023
Match List I with List II :\nList I\nA. Iron\nB. Zinc\nC. Boron\nD. Molybdenum\nList II\nI. Synthesis of auxin\nII. Component of nitrate reductase\nIII. Activator of catalase\nIV. Cell elongation and differentiation\nChoose the correct answer from the options given below :
Read answer →Biology · PYQ NEET UG 2023
