OnlineCBT
Biology · HSEXUAL REPRODUCTION IN FLOWERING PLANTS
Practice questions & answers
Find a question, read its answer and explanation, then practise related questions.
Biology · Clear filters
2022 questions
Biology · PYQ NEET UG 2016(2)
How many hot spots of biodiversity in the world have been identified till date by Norman Myers?
Read answer →Biology · PYQ NEET UG 2021
Identify the INCORRECT pair.
Read answer →Biology · BIODIVERSITY AND CONSERVATION
Given below are two statements: Statement I: The IUCN Red List (2004) documents the extinction of 784 species in the last 500 years, which includes 359 vertebrates and 338 invertebrates. Statement II: The last twenty years alone have witnessed the disappearance of 270 recorded species from the wild. In the light of the above statements, choose the most appropriate answer from the options given below:
Read answer →Biology · The Living World
Given below are two statements: Statement I: Biological names are generally in Greek and written in bold script irrespective of their origin. Statement II: The first word in a biological name denotes the specific epithet, while the second component denotes the genus. In the light of the above statements, choose the most appropriate answer from the options given below:
Read answer →Biology · SEXUAL REPRODUCTION IN FLOWERING PLANTS
Given below are two statements: Statement I: The cells of the sporogenous tissue undergo meiotic divisions to form microspore tetrads. Statement II: Each cell of the sporogenous tissue is a potential pollen or microspore mother cell. In the light of the above statements, choose the correct answer:
Read answer →Biology · PYQ NEET UG 2023
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as -
Read answer →Biology · PYQ NEET UG 2021
When gene targeting involving gene amplification is attempted in an individual's tissue to treat disease, it is known as:
Read answer →Biology · PYQ NEET UG 2019(1)
Consider the following statements: i. Coenzyme or metal ion that is tightly bound to enzyme protein is called prosthetic group. ii. A complete catalytic active enzyme with its bound prosthetic group is called apoenzyme. Select the correct option.
Read answer →Biology · PYQ NEET UG 2023
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?
Read answer →Biology · PYQ NEET UG 2018
World Ozone Day is celebrated on
Read answer →Biology · PYQ NEET UG 2022
Which one of the following statement is not true regarding gel electrophoresis technique?
Read answer →Biology · PYQ NEET UG 2025
Given below are two statements : One is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : Cells of the tapetum possess dense cytoplasm and generally have more than one nucleus. Reason (R) : Presence of more than one nucleus in the tapetum increases the efficiency of nourishing the developing microspore mother cells. In light of the above statements, choose the most appropriate answer from the options given below :
Read answer →Biology · PYQ NEET UG 2018
Use of bioresources by multinational companies and organisations without authorisation from the concerned country and its people is called
Read answer →Biology · PYQ NEET UG 2021
In a cross between a male and female, both heterozygous for sickle cell anaemia gene, what percentage of the progeny will be diseased?
Read answer →Biology · PLANT KINGDOM
Which two organisms represent the extreme size spectrum of Angiosperms from microscopic to tall tree species, respectively?
Read answer →Biology · PYQ NEET UG 2016(2)
Which hormones do stimulate the production of pancreatic juice and bicarbonate?
Read answer →Biology · PYQ NEET UG 2021
Match List-I with List-II\nList-I\n(a) Aspergillus niger\n(b) Acetobacter aceti\n(c) Clostridium butylicum\n(d) Lactobacillus\nList-II\n(i) Acetic Acid\n(ii) Lactic Acid\n(iii) Citric Acid\n(iv) Butyric Acid\nChoose the correct answer from the options given below:
Read answer →Biology · BIODIVERSITY AND CONSERVATION
Exploring molecular, genetic, and species-level diversity for products of economic importance is formally defined as:
Read answer →Biology · PYQ NEET UG 2019(2)
Non-membranous nucleoplasmic structures in nucleus are the site for active synthesis of
Read answer →Biology · PYQ NEET UG 2018
Plants having little or no secondary growth are
Read answer →Biology · CELL CYCLE AND CELL DIVISION
During anaphase of mitosis, as daughter chromosomes migrate toward opposite poles, the orientation of their structural regions is such that:
Read answer →Biology · PYQ NEET UG 2016(1)
Cotyledon of maize grain is called
Read answer →Biology · PYQ NEET UG 2019(1)
